Review



atac seq library preparation kit  (Illumina Inc)


Bioz Verified Symbol Illumina Inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    Illumina Inc atac seq library preparation kit
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Atac Seq Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 985 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc13000455-115-18-17
    Average 97 stars, based on 985 article reviews
    atac seq library preparation kit - by Bioz Stars, 2026-09
    97/100 stars

    Images

    1) Product Images from "Transient SUMOylation inhibition in human pre-adipocytes stably imprints a transcriptional beiging fate"

    Article Title: Transient SUMOylation inhibition in human pre-adipocytes stably imprints a transcriptional beiging fate

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkag232

    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A ) ATAC-seq experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Figure Legend Snippet: Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A ) ATAC-seq experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.

    Techniques Used: Activity Assay, Binding Assay, Western Blot

    Related Articles

    Recombinant:

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025 Article ll OPEN ACCESS

    Cell Viability Assay:

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025 Article ll OPEN ACCESS

    CRISPR:

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025

    Article Title: YAP1 is a key regulator of EWS::FLI1-dependent malignant transformation upon IGF-1-mediated reprogramming of bone mesenchymal stem cells
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-digoxigenin-alkaline phosphatase Roche Cat# 11093274910; RRID:AB_514497 AKT Cell Signaling Technology Cat# 4685; RRID:AB_2225340 B-Actin Abcam Cat# ab20272; RRID:AB_445482 CD90-2-APC BD Pharmingen Cat# 561974; RRID:AB_10895115 CD44-PE BD Pharmingen Cat# 561860; RRID:AB_10895375 CD45-APC BD Pharmingen Cat# 559864; RRID:AB_398672 CD19-APC-Cy7 BD Pharmingen Cat# 557655; RRID:AB_396770 FLI-1 (EPR4646) Abcam Cat# ab133485; RRID:AB_2722650 FOXM1 (EPR17379) Abcam Cat# ab207298; RRID:AB_3068347 GAPDH (D16H11)XP Cell Signaling Technology Cat# 5174; RRID:AB_10622025 HA tag (6E2) Cell Signaling Technology Cat# 2367; RRID:AB_10691311 IGF1R Cell Signaling Technology Cat# 3027; RRID:AB_2122378 KLF5 Abcam Cat# ab137676; RRID:AB_2744553 Laminin alpha 5/LAMA5 antibody [EPR18919] Abcam Cat# ab184330; p-Akt (Ser473) (D9E) Cell Signaling Technology Cat# 4060; RRID:AB_2315049 p-IGF-IR beta (Y1135/1136)/InsR beta (19H7) Cell Signaling Cat# 3024; RRID:AB_331253 YAP/TAZ (D24E4) Cell Signaling Technology Cat# 8418; RRID:AB_10950494 Chemicals, recombinant proteins, media Acetic anhydride Sigma-Aldrich Cat# 242845 Accutase Gibco Cat# A1110501 Alcian Blue Sigma Aldrich Cat# A5268-10G Alizarin Red Sigma-Aldrich Cat# A5533-25g CliniMACS buffer Miltenyi Biotec GmbH Cat# 130021201 Digitonin New England Biolabs Cat# 11175025910 Fetal Bovine Serum Gibco Cat# 10099158 Insuline Sigma-Aldrich Cat# 19278-5Ml IGF-1 ImmunoTools Cat# 11343316 K-975 MedChemExpress Cat# HY-138565; CAS: 2563855-03-6 Lipofectamine 2000 Invitrogen/ThermoFisher Cat# 11668019 NVP-AEW541 MedChemExpress Cat# HY-50866; CAS: 475489-16-8 Oligofectamine reagent Invitrogen/ThermoFisher Scientific Cat# 58303 Polybrene Milipore/Sigma Cat# TR-1003-G RPMI1640 Gibco Cat# 61870044 SeaPlaque GTG agarose Lonza Cat# 50111 Xylene substitute Thermo Scientific Cat# 9990505 Critical commercial assays CellTiter-Glo Luminescent Cell Viability Assay Promega Cat# G7570 Illumina Tagment DNA Enzyme and Buffer Small Kit Illumina Cat# 20034197 LentiCRISPR Yap1 sgRNA Crispr/Cas9 all in-one lentivector set mouse Applied Biological Materials (abm) Cat# 505841140595 (Continued on next page) Cell Reports 44, 115381, March 25, 2025 17 .. REAGENT or RESOURCE SOURCE IDENTIFIER Lenti-X Concentrator TaKaRa Cat# 631232 MesenCult adipogenic differentiation kit Stem Cell Technologies Cat# 05412 MesenCult osteogenic stimulatory kit Stem Cell Technologies Cat# 05504 MesenCult-ACF chondrogenic differentiation kit Stem Cell Technologies Cat# 05455 NEBNext Poly(A) mRNA Magnetic Isolation Module New England BioLabs Cat# E7490S ON-TARGETplus SMARTpool mouse siRNAs against Yap1 Dharmacon/Horizon Cat# L-012200-00-0005 ON-TARGETplus non-targeting pool Dharmacon/Horizon Cat# D-001810-10-20 RNA DIG labelling kit Roche Cat# 11175025910 RNeasy Mini Kit (250) QUIAGEN Cat# 74106 Genomic DNA Purification Kit Monarch Cat# T3010S Deposited data RNA-seq This paper GEO: GSE269006 ATAC-seq This paper GEO: GSE269004 Experimental Model and Study Participant Details: Cell lines A673 American Type Culture Collection Cat# CRL-1598 Lenti-X293T cells Takara Cat# 632180 Ewing sarcoma cell line STA-ET-1 Generated in-house STA-ET-1 Ewing sarcoma cell line SK-N-MC June Biedler (Memorial Sloan Kettering Cancer Center (New York, USA) SK-N-MC EFPrx1 MSCLC This paper N/A hr-EFPrx1 MSCLC This paper N/A Experimental Model and Study Participant Details: Organisms/strains Cre-inducible EWS/FLI-1 mouse (Rosa26loxP-STOPloxP-HA-EF) Suzanne Baker (St. Jude Children’s Research Hospital) Torchia et al. 37 Prx1-Cre mouse Malcolm Logan (King’s College, London, UK) Logan et al. 38 SCID mice (C.B-17/Prkcdscid) Charles River Laboratories C.B-17/Prkcdscid hr-EFPrx1 xenografts This paper N/A Oligonucleotides Primer: Yap1 Forward: ACCCTCGTTTTGCCATGAAC This paper N/A Primer: Yap1 Reverse: TGTGCTGGGATTGATATTCCGTA This paper N/A Primer: Igf2bp1 Forward: CGGCAACCTCAACGAGAGT This paper N/A Primer: Igf2bp1 Reverse: GCGTAGCCGGATTTGACCAA This paper N/A Primer: Hpf1 Forward: TGGGGTACTCGCTTGAACAG This paper N/A Primer: Hpf1 Reverse: CAAGCCTGCACCATGAAAGG This paper N/A Primer: Cenpq Forward: AATGTGCAACACTGAAAGTCCC This paper N/A Primer: Cenpq Reverse: ATTCTGGTTTGGAATTAGTGCCA This paper N/A Primer: Ccnd1 Forward: GCGTACCCTGACACCAATCTC This paper N/A (Continued on next page) 18 Cell Reports 44, 115381, March 25, 2025 Article ll OPEN ACCESS

    other:

    Article Title: TAF1 is required for fetal but not adult hematopoiesis in mice.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Vav1-Cre+; Taf1 fl/fl (Y) / C57BL/6 This paper N/A Oligonucleotides Mouse Taqman gene expression assay Taf1 (Mm01229178_m1, spanning E3 and E4) Thermo Fisher Scientific Cat#: 4351372 Mouse Taqman gene expression assay (Taf1 Mm01229177_m1, spanning E38 and 39) Thermo Fisher Scientific Cat#: 4351372 Mouse Taqman gene expression assay Rps6 Mm02342455_g1 Thermo Fisher Scientific Cat#: 4351372 Mouse Taqman gene expression assay Lmo1 Mm00475438_m1 Thermo Fisher Scientific Cat#: 4331182 Mouse Taqman gene expression assay Hprt1 Mm01545399_m1 Thermo Fisher Scientific Cat#: 4331182 Mouse Taqman gene expression assay Id1 Mm03676649_s1 Thermo Fisher Scientific Cat#: 4351372 Mouse Taqman gene expression assay 18s Mm03928990_g1 Thermo Fisher Scientific Cat#: 4426961 Forward primer for detecting Taf1 Exon 2/3 deletion in genomic DNA: GTTAACTCTAGTAAGGTTATCAGA ACCGCCACTG This paper N/A Reverse primer for detecting Taf1 Exon 2/3 deletion in genomic DNA: GCAGGCAAGAACAATGGCAGAG This paper N/A Recombinant DNA LT3GEPIR-shRNA (sh1:targeting Taf1 #1) Memorial Sloan-kettering Cancer Center N/A LT3GEPIR-shRNA (sh2:targeting Taf1 #2) Memorial Sloan-kettering Cancer Center N/A LT3GEPIR-shRNA (shLuc:non-targeting) Memorial Sloan-kettering Cancer Center N/A psPAX2 vector Addgene Plasmid #12260 pMD2.G Addgene Plasmid #12259 Software and algorithms FlowJo software FlowJo RRID: SCR_008520 GraphPad Prism 8 Graphpad Software RRID: SCR_000306 Transnetyx Colony Management Transnetyx N/A Scanpy https://github.com/theislab/scanpy RRID: SCR_018139 Scrublet https://github.com/AllonKleinLab/scrublet RRID: SCR_018098 Anndata https://github.com/theislab/anndata RRID: SCR_018209 ForceAtlas2 https://github.com/medialab/ benchmarkForceAtlas2 N/A Star http://tabit.ucsd.edu/sdec/ RRID: SCR_005622 RSEM http://deweylab.biostat.wisc.edu/rsem/ RRID: SCR_000262 Tximport https://github.com/mikelove/tximport RRID: SCR_016752 DEseq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID: SCR_015687 MACS https://github.com/macs3-project/MACS RRID: SCR_013291 BedTools https://github.com/arq5x/bedtools2 RRID: SCR_006646 Gencode https://www.gencodegenes.org RRID: SCR_014966 Bowtie http://bowtie-bio.sourceforge.net/ index.shtml RRID: SCR_005476 Homer http://homer.ucsd.edu/ RRID: SCR_010881 Deeptools https://deeptools.readthedocs.io/ en/develop/ RRID: SCR_016366 (Continued on next page) e4 Developmental Cell 60, 1–16.e1–e8, December 15, 2025

    Article Title: The transcriptional repressor BLIMP1 enforces TCF-1-dependent and -independent restriction of the memory fate of CD8 + T cells.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains LCMV-Armstrong prepared in lab N/A LCMV-clone 13 prepared in lab N/A Listeria monocytogenes-GP DMX Cat#09-080 Chemicals, peptides, and recombinant proteins Carboxyfluorescein succinimidyl ester (CFSE) Sigma Aldrich Cat#21888 LCMV-gp33-41 peptide GenScript custom ordered ERCC Spike-in control RNA Thermofisher Cat# 4456740 DNaseI Sigma Aldrich Cat # 260913-10MU Liberase Sigma Aldrich Cat#5401020001 Cas9 V3 nuclease IDT Cat#1081059 Diphtheria toxin Sigma Aldrich Cat # D0564 Tamoxifen Sigma Aldrich Cat #T5648 Recombinant mouse IL-2 PeproTech Cat # 212-12 Recombinant mouse IL-12 R&D Cat # 419-ML-010 Recombinant mouse IL-15 PeproTech Cat # 200-15 Brefeldin A Biolegend Cat# 420601 4% paraformaldehyde Electron Microscopy Cat# 15710 DNase Worthington Cat # LS002007 Critical commercial assays Alt-R Cas9 Electroporation Enhancer IDT Cat#1075915 P3 Primary Cell 4D-Nucleofector® X Kit S Lonza Cat# V4XP-3032 Precision Count Beads BioLegend Cat # 424902 Dynabeads FlowComp Mouse CD8 isolation kit Thermofisher Cat #114-62D MojoSort CD8 T cell negative enrichment kit Biolegend Cat # 480035 Lymphopure lymphocyte separation medium Biolegend Cat # 426202 LIVE/DEAD Aqua Thermofisher Cat # L34966 LIVE/DEAD Near-IR Thermofisher Cat # L34976 eBioscience Foxp3 / Transcription Factor Staining Buffer kit Thermofisher Cat # 50-112-8857 TriReagent Sigma Cat # T9424-200ML qScript cDNA SuperMix Quantabio Cat # 95048-500 Luminaris Color HiGreen qPCR Master Mix Thermofisher Cat # K0394 Protease inhibitor cocktail Sigma Aldrich Cat# P8340 QIAquick PCR Purification Kit Qiagen Cat# 28104 Direct-zol RNA Microprep Kit Zymo Research Cat# R2062 Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat # 20034197 AMPure XP beads Beckman Coulter Cat # A63880 EZ DNA Methylation-Direct Kit Zymo Research Cat # D5021 Zymoclean Gel DNA Recovery Kit Zymo Research Cat # D4008 Native Barcoding Kit 24 V14 Oxford Nanopore Technologies Cat# SQK-NBD114.24 10x Genomics Single Cell Immune Profiling Solution Kit N/A Deposited data scATAC-seq of 8 dpi LCMVArm this paper GEO: GSE295247 scRNA-seq of 8 dpi LCMVArm this paper GEO: GSE295246 Bulk ATAC-seq of TPEX and TEX this paper GEO: GSE294878 Bulk ATACseq of WT, Prdm1, Tcf7, and DKO TPEX this paper GEO: GSE294879 (Continued on next page) Immunity 58, 2472–2488.e1–e9, October 14, 2025 e3

    cDNA Synthesis:

    Article Title:
    Article Snippet: EP enhancer IDT Cat# 1075916 CloneR Stemcell Technologies Cat# 05888 Pierce IP lysis buffer ThermoFisher Scientific Cat# 87787 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 87786 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 78420 BSA ThermoFisher Scientific Cat# 23209 Sample Buffer, Laemmli 2× Concentrate Sigma Cat# S3401-10VL 10x Tris/Glycine/SDS Bio-Rad Cat# 1610732 10x Tris Buffered Saline Bio-Rad Cat# 1706435 Dried Skimmed Milk Powder Marvel N/A ECL detection reagent Amersham Cat# RPN2236 Protein G Sepharose®, Fast Flow Sigma Cat# P3296 Paraformaldehyde, 4% in PBS Alfa Aesar Cat# J61899 Live/DeadTM Fixable Near-IR Dead Cell Stain Invitrogen Cat# L34976 Normal donkey serum Jackson ImmunoResearch Cat# 017-000-121 DAPI Sigma Cat# D9564 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 di(N-succimidyl) glutarate Sigma-Aldrich Cat# 80424 PierceTM 16% Formaldehyde (w/v), Methanol-free ThermoFisher Scientific Cat# 28908 Glycine Sigma-Aldrich Cat# 50046 Tris-HCl, pH 7.5 In house1 N/A Tris, pH 8.0 In house1 N/A EDTA ThermoFisher Scientific Cat# 87788 EDTA Sigma Cat# E7889 SDS ThermoFisher Scientific Cat# AM9820 Triton X-100 Sigma Cat# T8787 HEPES, pH 7.9 Sigma Cat# H3375 Sodium deoxycholate Sigma Cat# 30970 LiCl Sigma Cat# L7026 NP-40 Alternative Sigma Cat# 18896 RNase A ThermoFisher Scientific Cat# E0531 Proteinase K ThermoFisher Scientific Cat# 78437 Tris-HCl, pH 7.4 In house1 N/A MgCl2 In house1 N/A NaCl Sigma Cat# S5150 Water ThermoFisher Scientific Cat# AM9937 .. P3 Primary Cell 4D-NucleofectorTM X Kit L Lonza Cat# V4XP-3024 RNeasy Micro Kit Qiagen Cat# 74004 Maxima First Strand cDNA Synthesis kit with dsDNase ThermoFisher Scientific Cat# K1671 Taqman Universal qRT-PCR Master Mix ThermoFisher Scientific Cat# 4304437 Pierce BCA Protein Assay Kit ThermoFisher Scientific Cat# 23225 REAGENT or RESOURCE SOURCE IDENTIFIER 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels Bio-Rad Cat# 4561085 Trans-Blot Turbo Mini 0.2 μm PVDF Transfer Packs Bio-Rad Cat# 1704156 HyperfilmTM ECLTM Amersham Cat# 28-9068-36 Duoluk In Situ Red Started Kit Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT KAPA mRNA polyA HyperPrep Kit Illumina Cat# KR1352 Dynabeads Protein G ThermoFisher Scientific Cat# 10003D Dynabeads Protein A ThermoFisher Scientific Cat# 10008D KAPA pure beads Roche Cat# 07893271001 Zymo Clean & Concetrator-5 Kit Zymo Research Cat# D4014 NEB Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7103 Illumina Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat# 20034197 NEBNext HiFi 2X PCR Master Mix New England BioLabs Cat# M0541S QubitTM dsDNA HS assay ThermoFisher Scientific Cat# Q32851 .. qRT-PCR Taqman Probes ThermoFisher Scientific Supplemental Table 2 Primers for indexing ATAC-seq libraries (Buenrostro et al. 2013) Supplemental Table 3

    Quantitative RT-PCR:

    Article Title:
    Article Snippet: EP enhancer IDT Cat# 1075916 CloneR Stemcell Technologies Cat# 05888 Pierce IP lysis buffer ThermoFisher Scientific Cat# 87787 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 87786 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 78420 BSA ThermoFisher Scientific Cat# 23209 Sample Buffer, Laemmli 2× Concentrate Sigma Cat# S3401-10VL 10x Tris/Glycine/SDS Bio-Rad Cat# 1610732 10x Tris Buffered Saline Bio-Rad Cat# 1706435 Dried Skimmed Milk Powder Marvel N/A ECL detection reagent Amersham Cat# RPN2236 Protein G Sepharose®, Fast Flow Sigma Cat# P3296 Paraformaldehyde, 4% in PBS Alfa Aesar Cat# J61899 Live/DeadTM Fixable Near-IR Dead Cell Stain Invitrogen Cat# L34976 Normal donkey serum Jackson ImmunoResearch Cat# 017-000-121 DAPI Sigma Cat# D9564 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 di(N-succimidyl) glutarate Sigma-Aldrich Cat# 80424 PierceTM 16% Formaldehyde (w/v), Methanol-free ThermoFisher Scientific Cat# 28908 Glycine Sigma-Aldrich Cat# 50046 Tris-HCl, pH 7.5 In house1 N/A Tris, pH 8.0 In house1 N/A EDTA ThermoFisher Scientific Cat# 87788 EDTA Sigma Cat# E7889 SDS ThermoFisher Scientific Cat# AM9820 Triton X-100 Sigma Cat# T8787 HEPES, pH 7.9 Sigma Cat# H3375 Sodium deoxycholate Sigma Cat# 30970 LiCl Sigma Cat# L7026 NP-40 Alternative Sigma Cat# 18896 RNase A ThermoFisher Scientific Cat# E0531 Proteinase K ThermoFisher Scientific Cat# 78437 Tris-HCl, pH 7.4 In house1 N/A MgCl2 In house1 N/A NaCl Sigma Cat# S5150 Water ThermoFisher Scientific Cat# AM9937 .. P3 Primary Cell 4D-NucleofectorTM X Kit L Lonza Cat# V4XP-3024 RNeasy Micro Kit Qiagen Cat# 74004 Maxima First Strand cDNA Synthesis kit with dsDNase ThermoFisher Scientific Cat# K1671 Taqman Universal qRT-PCR Master Mix ThermoFisher Scientific Cat# 4304437 Pierce BCA Protein Assay Kit ThermoFisher Scientific Cat# 23225 REAGENT or RESOURCE SOURCE IDENTIFIER 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels Bio-Rad Cat# 4561085 Trans-Blot Turbo Mini 0.2 μm PVDF Transfer Packs Bio-Rad Cat# 1704156 HyperfilmTM ECLTM Amersham Cat# 28-9068-36 Duoluk In Situ Red Started Kit Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT KAPA mRNA polyA HyperPrep Kit Illumina Cat# KR1352 Dynabeads Protein G ThermoFisher Scientific Cat# 10003D Dynabeads Protein A ThermoFisher Scientific Cat# 10008D KAPA pure beads Roche Cat# 07893271001 Zymo Clean & Concetrator-5 Kit Zymo Research Cat# D4014 NEB Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7103 Illumina Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat# 20034197 NEBNext HiFi 2X PCR Master Mix New England BioLabs Cat# M0541S QubitTM dsDNA HS assay ThermoFisher Scientific Cat# Q32851 .. qRT-PCR Taqman Probes ThermoFisher Scientific Supplemental Table 2 Primers for indexing ATAC-seq libraries (Buenrostro et al. 2013) Supplemental Table 3

    Bicinchoninic Acid Protein Assay:

    Article Title:
    Article Snippet: EP enhancer IDT Cat# 1075916 CloneR Stemcell Technologies Cat# 05888 Pierce IP lysis buffer ThermoFisher Scientific Cat# 87787 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 87786 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 78420 BSA ThermoFisher Scientific Cat# 23209 Sample Buffer, Laemmli 2× Concentrate Sigma Cat# S3401-10VL 10x Tris/Glycine/SDS Bio-Rad Cat# 1610732 10x Tris Buffered Saline Bio-Rad Cat# 1706435 Dried Skimmed Milk Powder Marvel N/A ECL detection reagent Amersham Cat# RPN2236 Protein G Sepharose®, Fast Flow Sigma Cat# P3296 Paraformaldehyde, 4% in PBS Alfa Aesar Cat# J61899 Live/DeadTM Fixable Near-IR Dead Cell Stain Invitrogen Cat# L34976 Normal donkey serum Jackson ImmunoResearch Cat# 017-000-121 DAPI Sigma Cat# D9564 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 di(N-succimidyl) glutarate Sigma-Aldrich Cat# 80424 PierceTM 16% Formaldehyde (w/v), Methanol-free ThermoFisher Scientific Cat# 28908 Glycine Sigma-Aldrich Cat# 50046 Tris-HCl, pH 7.5 In house1 N/A Tris, pH 8.0 In house1 N/A EDTA ThermoFisher Scientific Cat# 87788 EDTA Sigma Cat# E7889 SDS ThermoFisher Scientific Cat# AM9820 Triton X-100 Sigma Cat# T8787 HEPES, pH 7.9 Sigma Cat# H3375 Sodium deoxycholate Sigma Cat# 30970 LiCl Sigma Cat# L7026 NP-40 Alternative Sigma Cat# 18896 RNase A ThermoFisher Scientific Cat# E0531 Proteinase K ThermoFisher Scientific Cat# 78437 Tris-HCl, pH 7.4 In house1 N/A MgCl2 In house1 N/A NaCl Sigma Cat# S5150 Water ThermoFisher Scientific Cat# AM9937 .. P3 Primary Cell 4D-NucleofectorTM X Kit L Lonza Cat# V4XP-3024 RNeasy Micro Kit Qiagen Cat# 74004 Maxima First Strand cDNA Synthesis kit with dsDNase ThermoFisher Scientific Cat# K1671 Taqman Universal qRT-PCR Master Mix ThermoFisher Scientific Cat# 4304437 Pierce BCA Protein Assay Kit ThermoFisher Scientific Cat# 23225 REAGENT or RESOURCE SOURCE IDENTIFIER 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels Bio-Rad Cat# 4561085 Trans-Blot Turbo Mini 0.2 μm PVDF Transfer Packs Bio-Rad Cat# 1704156 HyperfilmTM ECLTM Amersham Cat# 28-9068-36 Duoluk In Situ Red Started Kit Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT KAPA mRNA polyA HyperPrep Kit Illumina Cat# KR1352 Dynabeads Protein G ThermoFisher Scientific Cat# 10003D Dynabeads Protein A ThermoFisher Scientific Cat# 10008D KAPA pure beads Roche Cat# 07893271001 Zymo Clean & Concetrator-5 Kit Zymo Research Cat# D4014 NEB Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7103 Illumina Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat# 20034197 NEBNext HiFi 2X PCR Master Mix New England BioLabs Cat# M0541S QubitTM dsDNA HS assay ThermoFisher Scientific Cat# Q32851 .. qRT-PCR Taqman Probes ThermoFisher Scientific Supplemental Table 2 Primers for indexing ATAC-seq libraries (Buenrostro et al. 2013) Supplemental Table 3

    In Situ:

    Article Title:
    Article Snippet: EP enhancer IDT Cat# 1075916 CloneR Stemcell Technologies Cat# 05888 Pierce IP lysis buffer ThermoFisher Scientific Cat# 87787 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 87786 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 78420 BSA ThermoFisher Scientific Cat# 23209 Sample Buffer, Laemmli 2× Concentrate Sigma Cat# S3401-10VL 10x Tris/Glycine/SDS Bio-Rad Cat# 1610732 10x Tris Buffered Saline Bio-Rad Cat# 1706435 Dried Skimmed Milk Powder Marvel N/A ECL detection reagent Amersham Cat# RPN2236 Protein G Sepharose®, Fast Flow Sigma Cat# P3296 Paraformaldehyde, 4% in PBS Alfa Aesar Cat# J61899 Live/DeadTM Fixable Near-IR Dead Cell Stain Invitrogen Cat# L34976 Normal donkey serum Jackson ImmunoResearch Cat# 017-000-121 DAPI Sigma Cat# D9564 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 di(N-succimidyl) glutarate Sigma-Aldrich Cat# 80424 PierceTM 16% Formaldehyde (w/v), Methanol-free ThermoFisher Scientific Cat# 28908 Glycine Sigma-Aldrich Cat# 50046 Tris-HCl, pH 7.5 In house1 N/A Tris, pH 8.0 In house1 N/A EDTA ThermoFisher Scientific Cat# 87788 EDTA Sigma Cat# E7889 SDS ThermoFisher Scientific Cat# AM9820 Triton X-100 Sigma Cat# T8787 HEPES, pH 7.9 Sigma Cat# H3375 Sodium deoxycholate Sigma Cat# 30970 LiCl Sigma Cat# L7026 NP-40 Alternative Sigma Cat# 18896 RNase A ThermoFisher Scientific Cat# E0531 Proteinase K ThermoFisher Scientific Cat# 78437 Tris-HCl, pH 7.4 In house1 N/A MgCl2 In house1 N/A NaCl Sigma Cat# S5150 Water ThermoFisher Scientific Cat# AM9937 .. P3 Primary Cell 4D-NucleofectorTM X Kit L Lonza Cat# V4XP-3024 RNeasy Micro Kit Qiagen Cat# 74004 Maxima First Strand cDNA Synthesis kit with dsDNase ThermoFisher Scientific Cat# K1671 Taqman Universal qRT-PCR Master Mix ThermoFisher Scientific Cat# 4304437 Pierce BCA Protein Assay Kit ThermoFisher Scientific Cat# 23225 REAGENT or RESOURCE SOURCE IDENTIFIER 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels Bio-Rad Cat# 4561085 Trans-Blot Turbo Mini 0.2 μm PVDF Transfer Packs Bio-Rad Cat# 1704156 HyperfilmTM ECLTM Amersham Cat# 28-9068-36 Duoluk In Situ Red Started Kit Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT KAPA mRNA polyA HyperPrep Kit Illumina Cat# KR1352 Dynabeads Protein G ThermoFisher Scientific Cat# 10003D Dynabeads Protein A ThermoFisher Scientific Cat# 10008D KAPA pure beads Roche Cat# 07893271001 Zymo Clean & Concetrator-5 Kit Zymo Research Cat# D4014 NEB Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7103 Illumina Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat# 20034197 NEBNext HiFi 2X PCR Master Mix New England BioLabs Cat# M0541S QubitTM dsDNA HS assay ThermoFisher Scientific Cat# Q32851 .. qRT-PCR Taqman Probes ThermoFisher Scientific Supplemental Table 2 Primers for indexing ATAC-seq libraries (Buenrostro et al. 2013) Supplemental Table 3

    Polymerase Chain Reaction:

    Article Title:
    Article Snippet: EP enhancer IDT Cat# 1075916 CloneR Stemcell Technologies Cat# 05888 Pierce IP lysis buffer ThermoFisher Scientific Cat# 87787 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 87786 HaltTM Protease Inhibitor Cocktail ThermoFisher Scientific Cat# 78420 BSA ThermoFisher Scientific Cat# 23209 Sample Buffer, Laemmli 2× Concentrate Sigma Cat# S3401-10VL 10x Tris/Glycine/SDS Bio-Rad Cat# 1610732 10x Tris Buffered Saline Bio-Rad Cat# 1706435 Dried Skimmed Milk Powder Marvel N/A ECL detection reagent Amersham Cat# RPN2236 Protein G Sepharose®, Fast Flow Sigma Cat# P3296 Paraformaldehyde, 4% in PBS Alfa Aesar Cat# J61899 Live/DeadTM Fixable Near-IR Dead Cell Stain Invitrogen Cat# L34976 Normal donkey serum Jackson ImmunoResearch Cat# 017-000-121 DAPI Sigma Cat# D9564 Vectashield Antifade Mounting Medium Vector Laboratories Cat# H-1000-10 di(N-succimidyl) glutarate Sigma-Aldrich Cat# 80424 PierceTM 16% Formaldehyde (w/v), Methanol-free ThermoFisher Scientific Cat# 28908 Glycine Sigma-Aldrich Cat# 50046 Tris-HCl, pH 7.5 In house1 N/A Tris, pH 8.0 In house1 N/A EDTA ThermoFisher Scientific Cat# 87788 EDTA Sigma Cat# E7889 SDS ThermoFisher Scientific Cat# AM9820 Triton X-100 Sigma Cat# T8787 HEPES, pH 7.9 Sigma Cat# H3375 Sodium deoxycholate Sigma Cat# 30970 LiCl Sigma Cat# L7026 NP-40 Alternative Sigma Cat# 18896 RNase A ThermoFisher Scientific Cat# E0531 Proteinase K ThermoFisher Scientific Cat# 78437 Tris-HCl, pH 7.4 In house1 N/A MgCl2 In house1 N/A NaCl Sigma Cat# S5150 Water ThermoFisher Scientific Cat# AM9937 .. P3 Primary Cell 4D-NucleofectorTM X Kit L Lonza Cat# V4XP-3024 RNeasy Micro Kit Qiagen Cat# 74004 Maxima First Strand cDNA Synthesis kit with dsDNase ThermoFisher Scientific Cat# K1671 Taqman Universal qRT-PCR Master Mix ThermoFisher Scientific Cat# 4304437 Pierce BCA Protein Assay Kit ThermoFisher Scientific Cat# 23225 REAGENT or RESOURCE SOURCE IDENTIFIER 4–15% Mini-PROTEAN® TGXTM Precast Protein Gels Bio-Rad Cat# 4561085 Trans-Blot Turbo Mini 0.2 μm PVDF Transfer Packs Bio-Rad Cat# 1704156 HyperfilmTM ECLTM Amersham Cat# 28-9068-36 Duoluk In Situ Red Started Kit Mouse/Rabbit Sigma-Aldrich Cat# DUO92101-1KT KAPA mRNA polyA HyperPrep Kit Illumina Cat# KR1352 Dynabeads Protein G ThermoFisher Scientific Cat# 10003D Dynabeads Protein A ThermoFisher Scientific Cat# 10008D KAPA pure beads Roche Cat# 07893271001 Zymo Clean & Concetrator-5 Kit Zymo Research Cat# D4014 NEB Ultra II DNA Library Prep Kit for Illumina New England BioLabs Cat# E7103 Illumina Tagment DNA TDE1 Enzyme and Buffer Small Kit Illumina Cat# 20034197 NEBNext HiFi 2X PCR Master Mix New England BioLabs Cat# M0541S QubitTM dsDNA HS assay ThermoFisher Scientific Cat# Q32851 .. qRT-PCR Taqman Probes ThermoFisher Scientific Supplemental Table 2 Primers for indexing ATAC-seq libraries (Buenrostro et al. 2013) Supplemental Table 3

    Article Title: Response eQTLs, chromatin accessibility, and 3D chromatin structure in chondrocytes provide mechanistic insight into osteoarthritis risk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Talar cartilage from deceased donors The Gift of Hope Organ and Tissue Donor Network N/A Critical commercial assays RNeasy kit Qiagen # 74104 QIAamp DNA mini kit Qiagen # 51304 TruSeq Nano DNA LT Library Preparation Kit Illumina # FC-121-4001 Infinium Global Diversity Array-8 v.10 Kit Illumina # 20031669 Qubit ds DNA High Sensitivity assay kit Thermo Fisher Scientific # Q32854 Qubit RNA High sensitivity assay kit Thermo Fisher Scientific # Q32582 Tagment DNA Enzyme and buffer small kit Illumina # 20034197 High-Fidelity 2X PCR Master Mix New England Biolabs # M0541L DNA clean and concentrator kit Zymo Research # D4014 KAPA library quantification kit Roche # 07960298001 Nextera XT Index kit Illumina # FC-131-1001 NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina # 20024907 1M Tris-HCl, pH 8.0 Fisher Scientific # 15-567-025 5M NaCl Sigma-Aldrich # 71386-1L IGEPAL CA-630 Sigma-Aldrich # I8896-50ML Protease inhibitors Sigma-Aldrich # P8340 10% Triton X-100 Sigma-Aldrich # 93443-100ML 10% SDS Fisher Scientific # 15-553-027 Mbol restriction enzyme New England Biolabs # R0147 10X NEBuffer 2 New England Biolabs # B7002S 10 mM dCTP Fisher Scientific # 18-253-013 10 mM dGTP Fisher Scientific # 18-253-011 10 mM dTTP Fisher Scientific # 18-253-018 10 mM dATP Fisher Scientific # 18-253-015 Biotin-14-dATP Life Technologies # 19524-016 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L NEB T4 DNA ligase buffer New England Biolabs # B0202 100X BSA New England Biolabs # B9000S AMPure XP beads Beckman Coulter # A63881 10% Triton X-100 Sigma-Aldrich # 93443-100ML T4 DNA ligase New England Biolabs # M0202M Proteinase K New England Biolabs # P8107S 10% SDS Fisher Scientific # 15-553-027 Ethanol Fisher Scientific # 07-678-003 3M sodium acetate Sigma-Aldrich # S7899-100ML AMPure XP beads Beckman Coulter # A63881 10X NEBuffer 2 New England Biolabs # B7002S Dynabeads MyOne Streptavidin T1 beads Life Technologies # 65602 Klenow Fragment (3’/5’ exo-) New England Biolabs # M0212 (Continued on next page) Cell Genomics 5, 100738, January 8, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Quick ligase New England Biolabs # M2200 T4 Polynucleotide Kinase New England Biolabs # M0201 T4 DNA polymerase I New England Biolabs # M0203 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L TruSeq Nano DNA LT Library Preparation Kit llumina # FC-121-4001 Deposited data Raw data This paper dbGaP: phs003581.v1.p1 Full eQTL summary statistics This paper https://msk.hugeamp.org/downloads.html GRC38 TOPMed reference panel TOPMed https://topmedimpute.readthedocs.io/en/ latest/reference-panels/ GENCODE.GRCh38.13 reference genome GENCODE https://www.gencodegenes.org/human/ release_38.html GENCODE.GRCh38.14 reference genome GENCODE https://www.gencodegenes.org/human/ release_44.html ENSEMBL version 97 (GRCh38.p12) hg38 cDNA assembly ENSEMBL https://ftp.ensembl.org/pub/release-97/ 1000 Genomes panels 1000 Genomes https://ftp.1000genomes.ebi.ac.uk/ vol1/ftp/ ENCODE blacklist regions ENCODE Accession ID: ENCFF356LFX OA differential expression data Ramos et al. ,27 Fisch et al.,28 Fu et al.29 Table S3, Table S1, GEO: GSE168505 GTEx sex-biased expression Oliva et al.34 GTEx portal (https://gtexportal.org/home/ datasets) GTEx age-related expression Yang et al.37 Supplementary Data S1 GRCh38.p14 build 156 dbSNP reference dbSNP https://ftp.ncbi.nih.gov/snp Low-grade and high-grade cartilage eQTLs Steinberg et al. 202116 https://msk.hugeamp.org/downloads OA GWAS summary statistics Boer et al. 20212 https://msk.hugeamp.org/downloads Software and algorithms Original pipelines for data processing This paper Zenodo https://doi.org/10.5281/zenodo.

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    Sensitive Assay:

    Article Title: Response eQTLs, chromatin accessibility, and 3D chromatin structure in chondrocytes provide mechanistic insight into osteoarthritis risk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Talar cartilage from deceased donors The Gift of Hope Organ and Tissue Donor Network N/A Critical commercial assays RNeasy kit Qiagen # 74104 QIAamp DNA mini kit Qiagen # 51304 TruSeq Nano DNA LT Library Preparation Kit Illumina # FC-121-4001 Infinium Global Diversity Array-8 v.10 Kit Illumina # 20031669 Qubit ds DNA High Sensitivity assay kit Thermo Fisher Scientific # Q32854 Qubit RNA High sensitivity assay kit Thermo Fisher Scientific # Q32582 Tagment DNA Enzyme and buffer small kit Illumina # 20034197 High-Fidelity 2X PCR Master Mix New England Biolabs # M0541L DNA clean and concentrator kit Zymo Research # D4014 KAPA library quantification kit Roche # 07960298001 Nextera XT Index kit Illumina # FC-131-1001 NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina # 20024907 1M Tris-HCl, pH 8.0 Fisher Scientific # 15-567-025 5M NaCl Sigma-Aldrich # 71386-1L IGEPAL CA-630 Sigma-Aldrich # I8896-50ML Protease inhibitors Sigma-Aldrich # P8340 10% Triton X-100 Sigma-Aldrich # 93443-100ML 10% SDS Fisher Scientific # 15-553-027 Mbol restriction enzyme New England Biolabs # R0147 10X NEBuffer 2 New England Biolabs # B7002S 10 mM dCTP Fisher Scientific # 18-253-013 10 mM dGTP Fisher Scientific # 18-253-011 10 mM dTTP Fisher Scientific # 18-253-018 10 mM dATP Fisher Scientific # 18-253-015 Biotin-14-dATP Life Technologies # 19524-016 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L NEB T4 DNA ligase buffer New England Biolabs # B0202 100X BSA New England Biolabs # B9000S AMPure XP beads Beckman Coulter # A63881 10% Triton X-100 Sigma-Aldrich # 93443-100ML T4 DNA ligase New England Biolabs # M0202M Proteinase K New England Biolabs # P8107S 10% SDS Fisher Scientific # 15-553-027 Ethanol Fisher Scientific # 07-678-003 3M sodium acetate Sigma-Aldrich # S7899-100ML AMPure XP beads Beckman Coulter # A63881 10X NEBuffer 2 New England Biolabs # B7002S Dynabeads MyOne Streptavidin T1 beads Life Technologies # 65602 Klenow Fragment (3’/5’ exo-) New England Biolabs # M0212 (Continued on next page) Cell Genomics 5, 100738, January 8, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Quick ligase New England Biolabs # M2200 T4 Polynucleotide Kinase New England Biolabs # M0201 T4 DNA polymerase I New England Biolabs # M0203 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L TruSeq Nano DNA LT Library Preparation Kit llumina # FC-121-4001 Deposited data Raw data This paper dbGaP: phs003581.v1.p1 Full eQTL summary statistics This paper https://msk.hugeamp.org/downloads.html GRC38 TOPMed reference panel TOPMed https://topmedimpute.readthedocs.io/en/ latest/reference-panels/ GENCODE.GRCh38.13 reference genome GENCODE https://www.gencodegenes.org/human/ release_38.html GENCODE.GRCh38.14 reference genome GENCODE https://www.gencodegenes.org/human/ release_44.html ENSEMBL version 97 (GRCh38.p12) hg38 cDNA assembly ENSEMBL https://ftp.ensembl.org/pub/release-97/ 1000 Genomes panels 1000 Genomes https://ftp.1000genomes.ebi.ac.uk/ vol1/ftp/ ENCODE blacklist regions ENCODE Accession ID: ENCFF356LFX OA differential expression data Ramos et al. ,27 Fisch et al.,28 Fu et al.29 Table S3, Table S1, GEO: GSE168505 GTEx sex-biased expression Oliva et al.34 GTEx portal (https://gtexportal.org/home/ datasets) GTEx age-related expression Yang et al.37 Supplementary Data S1 GRCh38.p14 build 156 dbSNP reference dbSNP https://ftp.ncbi.nih.gov/snp Low-grade and high-grade cartilage eQTLs Steinberg et al. 202116 https://msk.hugeamp.org/downloads OA GWAS summary statistics Boer et al. 20212 https://msk.hugeamp.org/downloads Software and algorithms Original pipelines for data processing This paper Zenodo https://doi.org/10.5281/zenodo.

    Library Quantification:

    Article Title: Response eQTLs, chromatin accessibility, and 3D chromatin structure in chondrocytes provide mechanistic insight into osteoarthritis risk.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Talar cartilage from deceased donors The Gift of Hope Organ and Tissue Donor Network N/A Critical commercial assays RNeasy kit Qiagen # 74104 QIAamp DNA mini kit Qiagen # 51304 TruSeq Nano DNA LT Library Preparation Kit Illumina # FC-121-4001 Infinium Global Diversity Array-8 v.10 Kit Illumina # 20031669 Qubit ds DNA High Sensitivity assay kit Thermo Fisher Scientific # Q32854 Qubit RNA High sensitivity assay kit Thermo Fisher Scientific # Q32582 Tagment DNA Enzyme and buffer small kit Illumina # 20034197 High-Fidelity 2X PCR Master Mix New England Biolabs # M0541L DNA clean and concentrator kit Zymo Research # D4014 KAPA library quantification kit Roche # 07960298001 Nextera XT Index kit Illumina # FC-131-1001 NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina # 20024907 1M Tris-HCl, pH 8.0 Fisher Scientific # 15-567-025 5M NaCl Sigma-Aldrich # 71386-1L IGEPAL CA-630 Sigma-Aldrich # I8896-50ML Protease inhibitors Sigma-Aldrich # P8340 10% Triton X-100 Sigma-Aldrich # 93443-100ML 10% SDS Fisher Scientific # 15-553-027 Mbol restriction enzyme New England Biolabs # R0147 10X NEBuffer 2 New England Biolabs # B7002S 10 mM dCTP Fisher Scientific # 18-253-013 10 mM dGTP Fisher Scientific # 18-253-011 10 mM dTTP Fisher Scientific # 18-253-018 10 mM dATP Fisher Scientific # 18-253-015 Biotin-14-dATP Life Technologies # 19524-016 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L NEB T4 DNA ligase buffer New England Biolabs # B0202 100X BSA New England Biolabs # B9000S AMPure XP beads Beckman Coulter # A63881 10% Triton X-100 Sigma-Aldrich # 93443-100ML T4 DNA ligase New England Biolabs # M0202M Proteinase K New England Biolabs # P8107S 10% SDS Fisher Scientific # 15-553-027 Ethanol Fisher Scientific # 07-678-003 3M sodium acetate Sigma-Aldrich # S7899-100ML AMPure XP beads Beckman Coulter # A63881 10X NEBuffer 2 New England Biolabs # B7002S Dynabeads MyOne Streptavidin T1 beads Life Technologies # 65602 Klenow Fragment (3’/5’ exo-) New England Biolabs # M0212 (Continued on next page) Cell Genomics 5, 100738, January 8, 2025 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DNA Quick ligase New England Biolabs # M2200 T4 Polynucleotide Kinase New England Biolabs # M0201 T4 DNA polymerase I New England Biolabs # M0203 DNA polymerase I, Large Klenow Fragment New England Biolabs # M0210L TruSeq Nano DNA LT Library Preparation Kit llumina # FC-121-4001 Deposited data Raw data This paper dbGaP: phs003581.v1.p1 Full eQTL summary statistics This paper https://msk.hugeamp.org/downloads.html GRC38 TOPMed reference panel TOPMed https://topmedimpute.readthedocs.io/en/ latest/reference-panels/ GENCODE.GRCh38.13 reference genome GENCODE https://www.gencodegenes.org/human/ release_38.html GENCODE.GRCh38.14 reference genome GENCODE https://www.gencodegenes.org/human/ release_44.html ENSEMBL version 97 (GRCh38.p12) hg38 cDNA assembly ENSEMBL https://ftp.ensembl.org/pub/release-97/ 1000 Genomes panels 1000 Genomes https://ftp.1000genomes.ebi.ac.uk/ vol1/ftp/ ENCODE blacklist regions ENCODE Accession ID: ENCFF356LFX OA differential expression data Ramos et al. ,27 Fisch et al.,28 Fu et al.29 Table S3, Table S1, GEO: GSE168505 GTEx sex-biased expression Oliva et al.34 GTEx portal (https://gtexportal.org/home/ datasets) GTEx age-related expression Yang et al.37 Supplementary Data S1 GRCh38.p14 build 156 dbSNP reference dbSNP https://ftp.ncbi.nih.gov/snp Low-grade and high-grade cartilage eQTLs Steinberg et al. 202116 https://msk.hugeamp.org/downloads OA GWAS summary statistics Boer et al. 20212 https://msk.hugeamp.org/downloads Software and algorithms Original pipelines for data processing This paper Zenodo https://doi.org/10.5281/zenodo.

    Lysis:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    Purification:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    DC Protein Assay:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    Plasmid Preparation:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    Sonication:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    RNA Sequencing:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis

    Single Cell:

    Article Title: Bivalent chromatin instructs lineage specification during hematopoiesis.
    Article Snippet: Article Bivalent chromatin instructs lineage specification during hematopoiesis



    Similar Products

    atac seq library preparation kit  (Illumina Inc)
    97
    Illumina Inc atac seq library preparation kit
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Atac Seq Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc13000455-115-18-17
    Average 97 stars, based on 1 article reviews
    atac seq library preparation kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    transposition mixture  (Illumina Inc)
    97
    Illumina Inc transposition mixture
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Transposition Mixture, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc13000455-121-13-22
    Average 97 stars, based on 1 article reviews
    transposition mixture - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    tagment tn5 transposase  (Illumina Inc)
    97
    Illumina Inc tagment tn5 transposase
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Tagment Tn5 Transposase, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc13000455-121-26-32
    Average 97 stars, based on 1 article reviews
    tagment tn5 transposase - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    td enzyme  (Illumina Inc)
    97
    Illumina Inc td enzyme
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Td Enzyme, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc12915527-164-26-29
    Average 97 stars, based on 1 article reviews
    td enzyme - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    tn5  (Illumina Inc)
    97
    Illumina Inc tn5
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Tn5, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/bio_rxiv__64898__2026__03__19__712964-252-31-32
    Average 97 stars, based on 1 article reviews
    tn5 - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    tagment dna enzyme and buffer kit  (Illumina Inc)
    97
    Illumina Inc tagment dna enzyme and buffer kit
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Tagment Dna Enzyme And Buffer Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc12771488-27-1-0
    Average 97 stars, based on 1 article reviews
    tagment dna enzyme and buffer kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    illumina tagment dna enzyme  (Illumina Inc)
    97
    Illumina Inc illumina tagment dna enzyme
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    Illumina Tagment Dna Enzyme, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pmc12771488-241-22-22
    Average 97 stars, based on 1 article reviews
    illumina tagment dna enzyme - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    a t ac seq library preparation kit  (Illumina Inc)
    97
    Illumina Inc a t ac seq library preparation kit
    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A <t>)</t> <t>ATAC-seq</t> experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.
    A T Ac Seq Library Preparation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/buffer+small+kit+illumina/Illumina+Tagment+DNA+Enzyme+and+Buffer+Small+Kit/pm41854078-127-26-25
    Average 97 stars, based on 1 article reviews
    a t ac seq library preparation kit - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier

    Image Search Results


    Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A ) ATAC-seq experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.

    Journal: Nucleic Acids Research

    Article Title: Transient SUMOylation inhibition in human pre-adipocytes stably imprints a transcriptional beiging fate

    doi: 10.1093/nar/gkag232

    Figure Lengend Snippet: Stable mobilization of CEBPs and PPARG upon transient TAK-981 treatment in pre-adipocytes. ( A ) ATAC-seq experimental layout in hTERT A41hWAT-SVF pre-adipocytes. Time series analysis and hierarchical clustering of significant variations in chromatin accessibility at day 0 (D0), 12 h (12h), and day (D7) after TAK-981 treatment. ( C ) GOBP analysis of ATAC-seq clusters 2 and 6 revealed in panel (B). See and for an analysis of all clusters. ( D – F ) Volcano plots displaying the results of ATAC-seq inferred differential TF activity analyses performed at D0, 12h, and D7 after TAK-981 or DMSO treatment. Colored dots indicate significant differentially mobilized TFs (TAK-981 versus DMSO). Differential binding score >0.05 and pAdj <0.001. ( G ) Time series analysis inferred TF activity over time (TAK-981 versus DMSO) at D0, 12h, and D7 after TAK-981 treatment. ( H ) Western blot analysis of CEBPB SUMOylation in DMSO and TAK-981-treated cells. ( I ) Western blot analysis of CEBPB and PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hTERT A41hWAT-SVF pre-adipocytes. ( J ) Western blot analysis of PPARG in DMSO, rosiglitazone, TAK-981-treated cells and cotreated hASCs.

    Article Snippet: Samples for assay for transposase-accessible chromatin sequencing (ATAC-seq) were prepared based on previously published protocols with the Illumina ATAC-seq library preparation kit (20034197) [ – ].

    Techniques: Activity Assay, Binding Assay, Western Blot